nf e2 Search Results


96
Proteintech rabbit anti nrf2
Rabbit Anti Nrf2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NRF2%2C+NFE2L2+Antibody/pmc09493374-34-2-4
Average 96 stars, based on 1 article reviews
rabbit anti nrf2 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
Rockland Immunochemicals nrf 2
Nrf 2, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/Nrf2+Antibody/pmc06598841-111-17-39
Average 94 stars, based on 1 article reviews
nrf 2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology nf e2
Binding of (A) EKLF, (B) GATA-1, (C) <t>NF-E2</t> and (D) CBP at β-globin regulatory elements. Blue bars depict untreated fetal liver samples, red bars DRB treated fetal liver samples and green bars α-amanitin treated fetal liver samples. Enrichment is relative to amylase. Error bars indicate standard error of mean.
Nf E2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NF-E2+Antibody/pmc02243019-188-5-16
Average 93 stars, based on 1 article reviews
nf e2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

88
MedChemExpress nrf2
SINO treatment relieves MCAO-induced cerebral injuries. (A) Representative micrographs of H&E staining of brain sections (x20 magnification; scale bar, 50 µm). (B) Brain water content analysis in brain tissues from Sham (sham-operated, n=6), SINO (treatment only, n=6), MCAO (MCAO-operated, n=6) and SINO/MCAO (MCAO operated plus SINO treatment, n=6). (C) Western blot analysis of <t>n-Nrf2,</t> HO-1 and NQO1 protein expression levels from brain tissue. The samples from two randomly selected brains in each group were presented. (D) Quantification of brain protein expression levels. All the experiments were repeated at least three times. The data are presented as the mean ± SEM. * P<0.05 and ** P<0.01 vs. Sham; # P<0.05 and ## P<0.01 vs. MCAO. HO-1, heme oxygenase-1; MCAO, middle cerebral artery occlusion; n-Nrf2, nuclear-nuclear factor-erythroid 2-related factor; NQO1, NAD(P)H: Quinoneoxidoreductase 1; SINO, sinomenine.
Nrf2, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/Nrf2+Antibody/pmc08097210-34-13-12
Average 88 stars, based on 1 article reviews
nrf2 - by Bioz Stars, 2026-09
88/100 stars
  Buy from Supplier

94
Proteintech 17745 1 ap
SINO treatment relieves MCAO-induced cerebral injuries. (A) Representative micrographs of H&E staining of brain sections (x20 magnification; scale bar, 50 µm). (B) Brain water content analysis in brain tissues from Sham (sham-operated, n=6), SINO (treatment only, n=6), MCAO (MCAO-operated, n=6) and SINO/MCAO (MCAO operated plus SINO treatment, n=6). (C) Western blot analysis of <t>n-Nrf2,</t> HO-1 and NQO1 protein expression levels from brain tissue. The samples from two randomly selected brains in each group were presented. (D) Quantification of brain protein expression levels. All the experiments were repeated at least three times. The data are presented as the mean ± SEM. * P<0.05 and ** P<0.01 vs. Sham; # P<0.05 and ## P<0.01 vs. MCAO. HO-1, heme oxygenase-1; MCAO, middle cerebral artery occlusion; n-Nrf2, nuclear-nuclear factor-erythroid 2-related factor; NQO1, NAD(P)H: Quinoneoxidoreductase 1; SINO, sinomenine.
17745 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NFE2L3+Antibody/pmc11509002-0-4-2
Average 94 stars, based on 1 article reviews
17745 1 ap - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Proteintech nf e2 related factor 2 nrf2
Effect of OSA-like IH on oxidative stress responses in melanoma lung metastasis mice. qRT-PCR analysis of SOD ( A ) and p22 phox ( B ) mRNA expression ( n = 6 per group) and western blotting analysis of <t>NRF2</t> protein expression ( C a ) in tumor tissue from mouse lungs after OSA-like IH exposure and/or tempol treatment ( n = 3 per group). The expression level of NRF2 was evaluated by densitometric analysis of western blot bands ( C b ). All data are expressed as the mean ± SEM. * P < 0.05, ** P < 0.01
Nf E2 Related Factor 2 Nrf2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NFE2+Antibody/pmc05809953-71-11-16
Average 93 stars, based on 1 article reviews
nf e2 related factor 2 nrf2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology nf e2p18
Effect of OSA-like IH on oxidative stress responses in melanoma lung metastasis mice. qRT-PCR analysis of SOD ( A ) and p22 phox ( B ) mRNA expression ( n = 6 per group) and western blotting analysis of <t>NRF2</t> protein expression ( C a ) in tumor tissue from mouse lungs after OSA-like IH exposure and/or tempol treatment ( n = 3 per group). The expression level of NRF2 was evaluated by densitometric analysis of western blot bands ( C b ). All data are expressed as the mean ± SEM. * P < 0.05, ** P < 0.01
Nf E2p18, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NF-E2+p18+Antibody/pmc03847324-166-17-18
Average 93 stars, based on 1 article reviews
nf e2p18 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Shanghai Korain Biotech Co Ltd bt lab elisa kit
Effect of OSA-like IH on oxidative stress responses in melanoma lung metastasis mice. qRT-PCR analysis of SOD ( A ) and p22 phox ( B ) mRNA expression ( n = 6 per group) and western blotting analysis of <t>NRF2</t> protein expression ( C a ) in tumor tissue from mouse lungs after OSA-like IH exposure and/or tempol treatment ( n = 3 per group). The expression level of NRF2 was evaluated by densitometric analysis of western blot bands ( C b ). All data are expressed as the mean ± SEM. * P < 0.05, ** P < 0.01
Bt Lab Elisa Kit, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/Rat+Nuclear+Factor+Erythroid+2-related+Factor+2/pmc13066924-98-44-44
Average 94 stars, based on 1 article reviews
bt lab elisa kit - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Shanghai Korain Biotech Co Ltd nrf 2
ROC Curve Analysis for <t>HO-1,</t> <t>Nrf-2</t> and SIRT-1. HO-1 (cut-off value 0.87, sensitivity 78.3%, specificity 76.7%); Nrf-2 (cut-off value 9.8 sensitivity 70%, specificity 73.3%); SIRT-1 (cut-off value 8.3, sensitivity 75%, specificity 70%). Abbreviations: HO-1: heme oxygenases-1; Nrf-2: nuclear factor erythroid 2-related factor 2; SIRT-1: Sirtuin 1
Nrf 2, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/Human+Nuclear+Factor+Erythroid+2-related+Factor+2/pmc13099689-147-2-17
Average 94 stars, based on 1 article reviews
nrf 2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Santa Cruz Biotechnology nfe2 sirna
MMP9, CD147, cathepsin B, p18 <t>NFE2,</t> p45 NFE2 and ADAMTSL-4 expression in ATII cells and lung tissue obtained from non-smokers (NS), smokers (SM) and patients with emphysema (E). MMP9, CD147 and cathepsin B expression in freshly isolated ATII cells ( A ) and lung tissue ( B ) as detected by Western blotting analysis. ( C ) MMP9, CD147, cathepsin B, p45 NFE2 and ADAMTSL-4 mRNA levels in lung tissue by RT-PCR. ( D,E ) p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in freshly isolated ATII cells ( D ) and lung tissue ( E ). Protein levels were analyzed by Western blotting. Densitometric analysis is also shown. *Statistically significant difference ( p < 0.05) is shown for comparison between non-smokers and smokers, between smokers and emphysema patients and between non-smokers and emphysema patients. Data are shown as the mean (±s.e.m.).
Nfe2 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NF-E2+siRNA/pmc05824795-213-9-11
Average 91 stars, based on 1 article reviews
nfe2 sirna - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
MedChemExpress nrf2 hy p81051 medchemexpress
MMP9, CD147, cathepsin B, p18 <t>NFE2,</t> p45 NFE2 and ADAMTSL-4 expression in ATII cells and lung tissue obtained from non-smokers (NS), smokers (SM) and patients with emphysema (E). MMP9, CD147 and cathepsin B expression in freshly isolated ATII cells ( A ) and lung tissue ( B ) as detected by Western blotting analysis. ( C ) MMP9, CD147, cathepsin B, p45 NFE2 and ADAMTSL-4 mRNA levels in lung tissue by RT-PCR. ( D,E ) p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in freshly isolated ATII cells ( D ) and lung tissue ( E ). Protein levels were analyzed by Western blotting. Densitometric analysis is also shown. *Statistically significant difference ( p < 0.05) is shown for comparison between non-smokers and smokers, between smokers and emphysema patients and between non-smokers and emphysema patients. Data are shown as the mean (±s.e.m.).
Nrf2 Hy P81051 Medchemexpress, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/Nrf2+Antibody/10__21203_slash_rs__3__rs___6978349_slash_v1-102-19-21
Average 93 stars, based on 1 article reviews
nrf2 hy p81051 medchemexpress - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
Proteintech antibodies against nrf1
Detection of endogenous <t>NRF1-742</t> and NRF1-772 proteins and their nuclear accumulation. ( A ) Schematic diagram of different isoforms of the human NRF1 transcripts. Green and white open boxes represent the coding and untranslated regions, respectively. The solid black lines represent the introns. The sequences are from the National Center for Biotechnology ( www.ncbi.hlm.nih.gov ) and Ensemble Genome Browser ( www.ensemble.org ), updated as of November 2019. ( B ) NRF1 protein expression in HaCaT cells exposed to iAs 3+ or vehicle (medium) for 6 h. Whole-cell lysates (WCL), cytosolic fractions (CF), and nuclear fractions (NF) from Cont -overexpressing (OE) ( C ), NRF1-742 -OE ( D ), and NRF1-772 -OE cells ( E ) following treatment with vehicle (medium) or 10 μM iAs 3+ for 6 h. To better visualize the weak bands, the films with weak bands (red boxes) were cut for another longer exposure following the initial exposure of the whole membrane (labeled as A2, E2).
Antibodies Against Nrf1, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nf+e2/NFE2L1+Antibody/pmc07139366-197-1-24
Average 92 stars, based on 1 article reviews
antibodies against nrf1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

Image Search Results


Binding of (A) EKLF, (B) GATA-1, (C) NF-E2 and (D) CBP at β-globin regulatory elements. Blue bars depict untreated fetal liver samples, red bars DRB treated fetal liver samples and green bars α-amanitin treated fetal liver samples. Enrichment is relative to amylase. Error bars indicate standard error of mean.

Journal: PLoS ONE

Article Title: Maintenance of Long-Range DNA Interactions after Inhibition of Ongoing RNA Polymerase II Transcription

doi: 10.1371/journal.pone.0001661

Figure Lengend Snippet: Binding of (A) EKLF, (B) GATA-1, (C) NF-E2 and (D) CBP at β-globin regulatory elements. Blue bars depict untreated fetal liver samples, red bars DRB treated fetal liver samples and green bars α-amanitin treated fetal liver samples. Enrichment is relative to amylase. Error bars indicate standard error of mean.

Article Snippet: Antibodies used: RNAPII (N-20; sc-899), NF-E2 (C-19; sc-291), GATA-1 (N6; sc-265) and CBP (A22; sc-369) from Santa Cruz Biotechnology, Ac-H3 (#06-599) and anti-tri-methyl Histone H3 K4 (#07-473) from Upstate, PanH3 (#ab1791) and anti-di-methyl Histone H3 K9/K27 (#ab7312) from Abcam.

Techniques: Binding Assay

SINO treatment relieves MCAO-induced cerebral injuries. (A) Representative micrographs of H&E staining of brain sections (x20 magnification; scale bar, 50 µm). (B) Brain water content analysis in brain tissues from Sham (sham-operated, n=6), SINO (treatment only, n=6), MCAO (MCAO-operated, n=6) and SINO/MCAO (MCAO operated plus SINO treatment, n=6). (C) Western blot analysis of n-Nrf2, HO-1 and NQO1 protein expression levels from brain tissue. The samples from two randomly selected brains in each group were presented. (D) Quantification of brain protein expression levels. All the experiments were repeated at least three times. The data are presented as the mean ± SEM. * P<0.05 and ** P<0.01 vs. Sham; # P<0.05 and ## P<0.01 vs. MCAO. HO-1, heme oxygenase-1; MCAO, middle cerebral artery occlusion; n-Nrf2, nuclear-nuclear factor-erythroid 2-related factor; NQO1, NAD(P)H: Quinoneoxidoreductase 1; SINO, sinomenine.

Journal: Experimental and Therapeutic Medicine

Article Title: Sinomenine activation of Nrf2 signaling prevents inflammation and cerebral injury in a mouse model of ischemic stroke

doi: 10.3892/etm.2021.10079

Figure Lengend Snippet: SINO treatment relieves MCAO-induced cerebral injuries. (A) Representative micrographs of H&E staining of brain sections (x20 magnification; scale bar, 50 µm). (B) Brain water content analysis in brain tissues from Sham (sham-operated, n=6), SINO (treatment only, n=6), MCAO (MCAO-operated, n=6) and SINO/MCAO (MCAO operated plus SINO treatment, n=6). (C) Western blot analysis of n-Nrf2, HO-1 and NQO1 protein expression levels from brain tissue. The samples from two randomly selected brains in each group were presented. (D) Quantification of brain protein expression levels. All the experiments were repeated at least three times. The data are presented as the mean ± SEM. * P<0.05 and ** P<0.01 vs. Sham; # P<0.05 and ## P<0.01 vs. MCAO. HO-1, heme oxygenase-1; MCAO, middle cerebral artery occlusion; n-Nrf2, nuclear-nuclear factor-erythroid 2-related factor; NQO1, NAD(P)H: Quinoneoxidoreductase 1; SINO, sinomenine.

Article Snippet: The following antibodies were used in the present study: SINO (MedChemExpress); ML385 (MedChemExpress); Nrf2, Keap1, NAD(P)H: Quinoneoxidoreductase (NQO1), Lamin B and HO-1 antibodies (Abcam); β-actin antibodies (Bioworld Technology, Inc.); NF-κB p65, Phosphorylated (p-)IκBα and IκBα antibodies (Cell Signaling Technology, Inc.); HRP-conjugated secondary antibodies (Bioworld Technology, Inc.); and Dylight488 conjugated goat anti-rabbit IgG secondary antibodies (Bioworld Technology, Inc.).

Techniques: Staining, Western Blot, Expressing

SINO treatment activates the Nrf2 signaling pathway. (A) BV2 cells were treated with a serial of doses of SINO for 24 h. HO-1 and NQO1 protein expression levels were assayed using western blotting. (B) BV2 cells were treated with SINO (200 µM) for various durations. HO-1 and NQO1 protein expression levels were assayed using western blotting. (C) BV2 cells were treated with SINO (200 µM) for 4 h. n-Nrf2 and t-Nrf2 protein expression levels were assayed using western blotting. Nuclear protein Lamin B and β-actin were used as controls. (D) BV2 cells were treated with serial doses of SINO for 24 h. The mRNA expression levels of HO-1 and NQO1 were measured using reverse transcription-semi-quantitative PCR. (E) Cell viability assay. BV2 cells were treated with various doses of SINO for 24 h. The cell viability was assayed by a CCK-8 kit. All the experiments were repeated at least three times. * P<0.05 and ** P<0.01 vs. Control HO-1, heme oxygenase-1; NQO1, NAD(P)H: Quinoneoxidoreductase 1; n-, nuclear; Nrf2; nuclear factor-erythroid 2-related factor; SINO, sinomenine; t-, total.

Journal: Experimental and Therapeutic Medicine

Article Title: Sinomenine activation of Nrf2 signaling prevents inflammation and cerebral injury in a mouse model of ischemic stroke

doi: 10.3892/etm.2021.10079

Figure Lengend Snippet: SINO treatment activates the Nrf2 signaling pathway. (A) BV2 cells were treated with a serial of doses of SINO for 24 h. HO-1 and NQO1 protein expression levels were assayed using western blotting. (B) BV2 cells were treated with SINO (200 µM) for various durations. HO-1 and NQO1 protein expression levels were assayed using western blotting. (C) BV2 cells were treated with SINO (200 µM) for 4 h. n-Nrf2 and t-Nrf2 protein expression levels were assayed using western blotting. Nuclear protein Lamin B and β-actin were used as controls. (D) BV2 cells were treated with serial doses of SINO for 24 h. The mRNA expression levels of HO-1 and NQO1 were measured using reverse transcription-semi-quantitative PCR. (E) Cell viability assay. BV2 cells were treated with various doses of SINO for 24 h. The cell viability was assayed by a CCK-8 kit. All the experiments were repeated at least three times. * P<0.05 and ** P<0.01 vs. Control HO-1, heme oxygenase-1; NQO1, NAD(P)H: Quinoneoxidoreductase 1; n-, nuclear; Nrf2; nuclear factor-erythroid 2-related factor; SINO, sinomenine; t-, total.

Article Snippet: The following antibodies were used in the present study: SINO (MedChemExpress); ML385 (MedChemExpress); Nrf2, Keap1, NAD(P)H: Quinoneoxidoreductase (NQO1), Lamin B and HO-1 antibodies (Abcam); β-actin antibodies (Bioworld Technology, Inc.); NF-κB p65, Phosphorylated (p-)IκBα and IκBα antibodies (Cell Signaling Technology, Inc.); HRP-conjugated secondary antibodies (Bioworld Technology, Inc.); and Dylight488 conjugated goat anti-rabbit IgG secondary antibodies (Bioworld Technology, Inc.).

Techniques: Expressing, Western Blot, Reverse Transcription, Real-time Polymerase Chain Reaction, Viability Assay, CCK-8 Assay, Control

SINO treatment regulates microglia polarization and inflammation in an Nrf2-dependent manner. BV2 cells were stimulated with OGD for 4 h followed by treatment with SINO (200 µM) for 12 h. The mRNA expression levels of (A) M1 markers (IL-6/NOS2) and (B) M2 markers (IL-10/Arg-1) were determined using RT-sqPCR. BV2 cells were pretreated with ML385 (5 µM) for 48 h to inhibit Nrf2 expression. Cells were then stimulated with OGD for 4 h followed by treatment with SINO (200 µM) for 12 h. The mRNA expression levels of (C) M1 and (D) M2 markers were measured using RT-sqPCR. The data are presented as the mean ± SEM of three independent experiments. * P<0.05 and ** P<0.01 vs. Control; ## P<0.01 vs. OGD. Arg-1, arginase-1; NOS2, nitric oxide synthase 2; OGD, oxygen and glucose deprivation; SINO, sinomenine; RT-sqPCR, reverse transcription-semi-quantitative PCR.

Journal: Experimental and Therapeutic Medicine

Article Title: Sinomenine activation of Nrf2 signaling prevents inflammation and cerebral injury in a mouse model of ischemic stroke

doi: 10.3892/etm.2021.10079

Figure Lengend Snippet: SINO treatment regulates microglia polarization and inflammation in an Nrf2-dependent manner. BV2 cells were stimulated with OGD for 4 h followed by treatment with SINO (200 µM) for 12 h. The mRNA expression levels of (A) M1 markers (IL-6/NOS2) and (B) M2 markers (IL-10/Arg-1) were determined using RT-sqPCR. BV2 cells were pretreated with ML385 (5 µM) for 48 h to inhibit Nrf2 expression. Cells were then stimulated with OGD for 4 h followed by treatment with SINO (200 µM) for 12 h. The mRNA expression levels of (C) M1 and (D) M2 markers were measured using RT-sqPCR. The data are presented as the mean ± SEM of three independent experiments. * P<0.05 and ** P<0.01 vs. Control; ## P<0.01 vs. OGD. Arg-1, arginase-1; NOS2, nitric oxide synthase 2; OGD, oxygen and glucose deprivation; SINO, sinomenine; RT-sqPCR, reverse transcription-semi-quantitative PCR.

Article Snippet: The following antibodies were used in the present study: SINO (MedChemExpress); ML385 (MedChemExpress); Nrf2, Keap1, NAD(P)H: Quinoneoxidoreductase (NQO1), Lamin B and HO-1 antibodies (Abcam); β-actin antibodies (Bioworld Technology, Inc.); NF-κB p65, Phosphorylated (p-)IκBα and IκBα antibodies (Cell Signaling Technology, Inc.); HRP-conjugated secondary antibodies (Bioworld Technology, Inc.); and Dylight488 conjugated goat anti-rabbit IgG secondary antibodies (Bioworld Technology, Inc.).

Techniques: Expressing, Control, Reverse Transcription, Real-time Polymerase Chain Reaction

SINO treatment regulates microglia inflammation in an Nrf2-dependent manner. (A) BV2 cells were pretreated with ML385 (5 µM) for 48 h to inhibit Nrf2 expression. Cells were then stimulated with OGD for 4 h followed by treatment with SINO (200 µM) for 12 h. The protein expression levels of p-IκBα and total IκBα were analyzed using western blotting. (B) Immuno-fluorescent staining of cells was performed using an NF-κB p65 primary antibody and Dylight488 conjugated secondary antibody (middle row of panels). The cells were also stained with DAPI (top row of panels) and merged with NF-κB images (lower row of panels). The data are presented as the mean ± SEM of three independent experiments. ** P<0.01 vs. Control; ## P<0.01 vs. OGD. OGD, oxygen and glucose deprivation; p-, phosphorylated; SINO, sinomenine.

Journal: Experimental and Therapeutic Medicine

Article Title: Sinomenine activation of Nrf2 signaling prevents inflammation and cerebral injury in a mouse model of ischemic stroke

doi: 10.3892/etm.2021.10079

Figure Lengend Snippet: SINO treatment regulates microglia inflammation in an Nrf2-dependent manner. (A) BV2 cells were pretreated with ML385 (5 µM) for 48 h to inhibit Nrf2 expression. Cells were then stimulated with OGD for 4 h followed by treatment with SINO (200 µM) for 12 h. The protein expression levels of p-IκBα and total IκBα were analyzed using western blotting. (B) Immuno-fluorescent staining of cells was performed using an NF-κB p65 primary antibody and Dylight488 conjugated secondary antibody (middle row of panels). The cells were also stained with DAPI (top row of panels) and merged with NF-κB images (lower row of panels). The data are presented as the mean ± SEM of three independent experiments. ** P<0.01 vs. Control; ## P<0.01 vs. OGD. OGD, oxygen and glucose deprivation; p-, phosphorylated; SINO, sinomenine.

Article Snippet: The following antibodies were used in the present study: SINO (MedChemExpress); ML385 (MedChemExpress); Nrf2, Keap1, NAD(P)H: Quinoneoxidoreductase (NQO1), Lamin B and HO-1 antibodies (Abcam); β-actin antibodies (Bioworld Technology, Inc.); NF-κB p65, Phosphorylated (p-)IκBα and IκBα antibodies (Cell Signaling Technology, Inc.); HRP-conjugated secondary antibodies (Bioworld Technology, Inc.); and Dylight488 conjugated goat anti-rabbit IgG secondary antibodies (Bioworld Technology, Inc.).

Techniques: Expressing, Western Blot, Staining, Control

Effect of OSA-like IH on oxidative stress responses in melanoma lung metastasis mice. qRT-PCR analysis of SOD ( A ) and p22 phox ( B ) mRNA expression ( n = 6 per group) and western blotting analysis of NRF2 protein expression ( C a ) in tumor tissue from mouse lungs after OSA-like IH exposure and/or tempol treatment ( n = 3 per group). The expression level of NRF2 was evaluated by densitometric analysis of western blot bands ( C b ). All data are expressed as the mean ± SEM. * P < 0.05, ** P < 0.01

Journal: Respiratory Research

Article Title: Intermittent hypoxia promotes melanoma lung metastasis via oxidative stress and inflammation responses in a mouse model of obstructive sleep apnea

doi: 10.1186/s12931-018-0727-x

Figure Lengend Snippet: Effect of OSA-like IH on oxidative stress responses in melanoma lung metastasis mice. qRT-PCR analysis of SOD ( A ) and p22 phox ( B ) mRNA expression ( n = 6 per group) and western blotting analysis of NRF2 protein expression ( C a ) in tumor tissue from mouse lungs after OSA-like IH exposure and/or tempol treatment ( n = 3 per group). The expression level of NRF2 was evaluated by densitometric analysis of western blot bands ( C b ). All data are expressed as the mean ± SEM. * P < 0.05, ** P < 0.01

Article Snippet: The primary antibodies, including HIF-1α (1:200; Novus Biologicals, Littleton, CO, USA), NF-E2-related factor 2 (NRF2) (1:200; ProteinTech Group, Chicago, IL, USA), NF-κB P65 (1:5000; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) and β-actin (1:5000; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), were used to probe the target proteins.

Techniques: Quantitative RT-PCR, Expressing, Western Blot

ROC Curve Analysis for HO-1, Nrf-2 and SIRT-1. HO-1 (cut-off value 0.87, sensitivity 78.3%, specificity 76.7%); Nrf-2 (cut-off value 9.8 sensitivity 70%, specificity 73.3%); SIRT-1 (cut-off value 8.3, sensitivity 75%, specificity 70%). Abbreviations: HO-1: heme oxygenases-1; Nrf-2: nuclear factor erythroid 2-related factor 2; SIRT-1: Sirtuin 1

Journal: Metabolic Brain Disease

Article Title: The SIRT-1/Nrf-2/HO-1 antioxidant defense axis in adult attention-deficit/hyperactivity disorder

doi: 10.1007/s11011-026-01845-5

Figure Lengend Snippet: ROC Curve Analysis for HO-1, Nrf-2 and SIRT-1. HO-1 (cut-off value 0.87, sensitivity 78.3%, specificity 76.7%); Nrf-2 (cut-off value 9.8 sensitivity 70%, specificity 73.3%); SIRT-1 (cut-off value 8.3, sensitivity 75%, specificity 70%). Abbreviations: HO-1: heme oxygenases-1; Nrf-2: nuclear factor erythroid 2-related factor 2; SIRT-1: Sirtuin 1

Article Snippet: Serum HO-1, NRF-2, and SIRT-1 concentrations were analyzed using ELISA kits according to the manufacturers’ standard protocols (BT Lab, Human Heme Oxygenase-1: Cat. No. E0932Hu; BT Lab, Human Nuclear Factor Erythroid 2-Related Factor 2: Cat. No. E3244Hu; BT Lab, Human Sirtuin-1: Cat. No. E2557Hu; Jiaxing Korain Biotech, Jiaxing, China) on a Rel Assay automated ELISA reader (Biobase Biodusty Co., Ltd., Jinan, China).

Techniques:

MMP9, CD147, cathepsin B, p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in ATII cells and lung tissue obtained from non-smokers (NS), smokers (SM) and patients with emphysema (E). MMP9, CD147 and cathepsin B expression in freshly isolated ATII cells ( A ) and lung tissue ( B ) as detected by Western blotting analysis. ( C ) MMP9, CD147, cathepsin B, p45 NFE2 and ADAMTSL-4 mRNA levels in lung tissue by RT-PCR. ( D,E ) p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in freshly isolated ATII cells ( D ) and lung tissue ( E ). Protein levels were analyzed by Western blotting. Densitometric analysis is also shown. *Statistically significant difference ( p < 0.05) is shown for comparison between non-smokers and smokers, between smokers and emphysema patients and between non-smokers and emphysema patients. Data are shown as the mean (±s.e.m.).

Journal: Scientific Reports

Article Title: The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema

doi: 10.1038/s41598-018-21790-3

Figure Lengend Snippet: MMP9, CD147, cathepsin B, p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in ATII cells and lung tissue obtained from non-smokers (NS), smokers (SM) and patients with emphysema (E). MMP9, CD147 and cathepsin B expression in freshly isolated ATII cells ( A ) and lung tissue ( B ) as detected by Western blotting analysis. ( C ) MMP9, CD147, cathepsin B, p45 NFE2 and ADAMTSL-4 mRNA levels in lung tissue by RT-PCR. ( D,E ) p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in freshly isolated ATII cells ( D ) and lung tissue ( E ). Protein levels were analyzed by Western blotting. Densitometric analysis is also shown. *Statistically significant difference ( p < 0.05) is shown for comparison between non-smokers and smokers, between smokers and emphysema patients and between non-smokers and emphysema patients. Data are shown as the mean (±s.e.m.).

Article Snippet: Cells with 80% confluency were transfected with 100 nM NFE2 siRNA (Santa Cruz, CA) or NT (non-targeting) siRNA: 5′ UAGCGACUAAACACAUCAAUU 3′ and 3′ UUAUCGCUGAUUUGUGUAGUU 5′.

Techniques: Expressing, Isolation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Comparison

p45 NFE2 and p18 NFE2 tyrosine phosphorylation in human ATII cells and lung tissue obtained from control non-smokers (NS) and smokers (SM) and patients with emphysema (E). Immunoprecipitation was performed in freshly isolated ATII cells ( A ) and lung tissue ( B ) followed by Western blotting analysis. Densitometric quantification is also shown. *Statistically significant difference ( p < 0.05). Data are shown as the mean (±s.e.m.).

Journal: Scientific Reports

Article Title: The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema

doi: 10.1038/s41598-018-21790-3

Figure Lengend Snippet: p45 NFE2 and p18 NFE2 tyrosine phosphorylation in human ATII cells and lung tissue obtained from control non-smokers (NS) and smokers (SM) and patients with emphysema (E). Immunoprecipitation was performed in freshly isolated ATII cells ( A ) and lung tissue ( B ) followed by Western blotting analysis. Densitometric quantification is also shown. *Statistically significant difference ( p < 0.05). Data are shown as the mean (±s.e.m.).

Article Snippet: Cells with 80% confluency were transfected with 100 nM NFE2 siRNA (Santa Cruz, CA) or NT (non-targeting) siRNA: 5′ UAGCGACUAAACACAUCAAUU 3′ and 3′ UUAUCGCUGAUUUGUGUAGUU 5′.

Techniques: Phospho-proteomics, Control, Immunoprecipitation, Isolation, Western Blot

NFE2 knockdown increases cell death induced by CSE in A549 cells in vitro . ( A ) A549 cells were transfected with 100 nM NFE2 siRNA or non-targeting (NT) siRNA followed by exposure to CSE for 24 h. Representative flow cytometry images using Annexin V and PI staining are shown. ( B ) NFE2 knockdown significantly increased cell death after treatment with CSE compared to control. *Statistically significant difference ( p < 0.05). Data are shown as the mean (±s.e.m.).

Journal: Scientific Reports

Article Title: The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema

doi: 10.1038/s41598-018-21790-3

Figure Lengend Snippet: NFE2 knockdown increases cell death induced by CSE in A549 cells in vitro . ( A ) A549 cells were transfected with 100 nM NFE2 siRNA or non-targeting (NT) siRNA followed by exposure to CSE for 24 h. Representative flow cytometry images using Annexin V and PI staining are shown. ( B ) NFE2 knockdown significantly increased cell death after treatment with CSE compared to control. *Statistically significant difference ( p < 0.05). Data are shown as the mean (±s.e.m.).

Article Snippet: Cells with 80% confluency were transfected with 100 nM NFE2 siRNA (Santa Cruz, CA) or NT (non-targeting) siRNA: 5′ UAGCGACUAAACACAUCAAUU 3′ and 3′ UUAUCGCUGAUUUGUGUAGUU 5′.

Techniques: Knockdown, In Vitro, Transfection, Flow Cytometry, Staining, Control

p45 NFE2 interaction with DJ-1 in ATII cells and lung tissue obtained from non-smokers (NS), smokers (SM) and patients with emphysema (E). DJ-1 was co-immunoprecipitated in freshly isolated ATII cells ( A ) or lung tissue ( B ) followed by Western blotting analysis to determine its interaction with p45 NFE2 or p18 NFE2 as described in Materials and Methods. Relative expression is also shown. ( C ) p45 NFE2 (green) and DJ-1 (red) expression in ATII cells identified using SP-A staining (violet) in lung tissue by immunohistofluorescence. Cell nuclei were stained with DAPI (blue). The strongest co-localization of p45 NFE2 and DJ-1 is indicated by white arrows. *Statistically significant difference ( p < 0.05). Data are shown as the mean (±s.e.m.).

Journal: Scientific Reports

Article Title: The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema

doi: 10.1038/s41598-018-21790-3

Figure Lengend Snippet: p45 NFE2 interaction with DJ-1 in ATII cells and lung tissue obtained from non-smokers (NS), smokers (SM) and patients with emphysema (E). DJ-1 was co-immunoprecipitated in freshly isolated ATII cells ( A ) or lung tissue ( B ) followed by Western blotting analysis to determine its interaction with p45 NFE2 or p18 NFE2 as described in Materials and Methods. Relative expression is also shown. ( C ) p45 NFE2 (green) and DJ-1 (red) expression in ATII cells identified using SP-A staining (violet) in lung tissue by immunohistofluorescence. Cell nuclei were stained with DAPI (blue). The strongest co-localization of p45 NFE2 and DJ-1 is indicated by white arrows. *Statistically significant difference ( p < 0.05). Data are shown as the mean (±s.e.m.).

Article Snippet: Cells with 80% confluency were transfected with 100 nM NFE2 siRNA (Santa Cruz, CA) or NT (non-targeting) siRNA: 5′ UAGCGACUAAACACAUCAAUU 3′ and 3′ UUAUCGCUGAUUUGUGUAGUU 5′.

Techniques: Immunoprecipitation, Isolation, Western Blot, Expressing, Staining, Immunohistofluorescence

MMP9, CD147, cathepsin B, p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in wild-type and DJ-1 KO mice. Wild-type (WT) ( A ) and DJ-1 KO mice ( B ) were exposed to 150 mg/m 3 cigarette smoke (CS) for 2 h/day for 3 weeks as described in Materials and Methods section. Protein levels were analyzed in lung tissue by Western blotting. Lane 1 – WT mice, Lane 2 – WT + CS, Lane 3 – DJ-1 KO mice, Lane 4 – DJ-1 KO mice + CS. Relative expression is also shown. ( C ) p45 NFE2 expression (green) in ATII cells identified using SP-A antibody (violet) in lung tissue obtained from wild-type and DJ-1 KO mice by immunohistofluorescence. Cell nuclei were stained with DAPI (blue). ( D , E ) MMP9, CD147, cathepsin B, p45 NFE2 and ADAMTSL-4 mRNA expression in lung tissue from wild-type ( D ) and DJ-1 KO ( E ) mice by RT-PCR. The strongest p45 NFE2 expression is indicated by white arrows. *Statistically significant difference in comparison with control ( p < 0.05). Data are shown as the mean (±s.e.m.).

Journal: Scientific Reports

Article Title: The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema

doi: 10.1038/s41598-018-21790-3

Figure Lengend Snippet: MMP9, CD147, cathepsin B, p18 NFE2, p45 NFE2 and ADAMTSL-4 expression in wild-type and DJ-1 KO mice. Wild-type (WT) ( A ) and DJ-1 KO mice ( B ) were exposed to 150 mg/m 3 cigarette smoke (CS) for 2 h/day for 3 weeks as described in Materials and Methods section. Protein levels were analyzed in lung tissue by Western blotting. Lane 1 – WT mice, Lane 2 – WT + CS, Lane 3 – DJ-1 KO mice, Lane 4 – DJ-1 KO mice + CS. Relative expression is also shown. ( C ) p45 NFE2 expression (green) in ATII cells identified using SP-A antibody (violet) in lung tissue obtained from wild-type and DJ-1 KO mice by immunohistofluorescence. Cell nuclei were stained with DAPI (blue). ( D , E ) MMP9, CD147, cathepsin B, p45 NFE2 and ADAMTSL-4 mRNA expression in lung tissue from wild-type ( D ) and DJ-1 KO ( E ) mice by RT-PCR. The strongest p45 NFE2 expression is indicated by white arrows. *Statistically significant difference in comparison with control ( p < 0.05). Data are shown as the mean (±s.e.m.).

Article Snippet: Cells with 80% confluency were transfected with 100 nM NFE2 siRNA (Santa Cruz, CA) or NT (non-targeting) siRNA: 5′ UAGCGACUAAACACAUCAAUU 3′ and 3′ UUAUCGCUGAUUUGUGUAGUU 5′.

Techniques: Expressing, Western Blot, Immunohistofluorescence, Staining, Reverse Transcription Polymerase Chain Reaction, Comparison, Control

The role of p45 NFE in ATII cells in non-smokers, smokers and emphysema patients.

Journal: Scientific Reports

Article Title: The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema

doi: 10.1038/s41598-018-21790-3

Figure Lengend Snippet: The role of p45 NFE in ATII cells in non-smokers, smokers and emphysema patients.

Article Snippet: Cells with 80% confluency were transfected with 100 nM NFE2 siRNA (Santa Cruz, CA) or NT (non-targeting) siRNA: 5′ UAGCGACUAAACACAUCAAUU 3′ and 3′ UUAUCGCUGAUUUGUGUAGUU 5′.

Techniques:

Detection of endogenous NRF1-742 and NRF1-772 proteins and their nuclear accumulation. ( A ) Schematic diagram of different isoforms of the human NRF1 transcripts. Green and white open boxes represent the coding and untranslated regions, respectively. The solid black lines represent the introns. The sequences are from the National Center for Biotechnology ( www.ncbi.hlm.nih.gov ) and Ensemble Genome Browser ( www.ensemble.org ), updated as of November 2019. ( B ) NRF1 protein expression in HaCaT cells exposed to iAs 3+ or vehicle (medium) for 6 h. Whole-cell lysates (WCL), cytosolic fractions (CF), and nuclear fractions (NF) from Cont -overexpressing (OE) ( C ), NRF1-742 -OE ( D ), and NRF1-772 -OE cells ( E ) following treatment with vehicle (medium) or 10 μM iAs 3+ for 6 h. To better visualize the weak bands, the films with weak bands (red boxes) were cut for another longer exposure following the initial exposure of the whole membrane (labeled as A2, E2).

Journal: International Journal of Molecular Sciences

Article Title: Overexpression of NRF1-742 or NRF1-772 Reduces Arsenic-Induced Cytotoxicity and Apoptosis in Human HaCaT Keratinocytes

doi: 10.3390/ijms21062014

Figure Lengend Snippet: Detection of endogenous NRF1-742 and NRF1-772 proteins and their nuclear accumulation. ( A ) Schematic diagram of different isoforms of the human NRF1 transcripts. Green and white open boxes represent the coding and untranslated regions, respectively. The solid black lines represent the introns. The sequences are from the National Center for Biotechnology ( www.ncbi.hlm.nih.gov ) and Ensemble Genome Browser ( www.ensemble.org ), updated as of November 2019. ( B ) NRF1 protein expression in HaCaT cells exposed to iAs 3+ or vehicle (medium) for 6 h. Whole-cell lysates (WCL), cytosolic fractions (CF), and nuclear fractions (NF) from Cont -overexpressing (OE) ( C ), NRF1-742 -OE ( D ), and NRF1-772 -OE cells ( E ) following treatment with vehicle (medium) or 10 μM iAs 3+ for 6 h. To better visualize the weak bands, the films with weak bands (red boxes) were cut for another longer exposure following the initial exposure of the whole membrane (labeled as A2, E2).

Article Snippet: The antibodies against NRF1 (17062-1-AP), NQO1 (11451-1-AP), GCLC (12601-1-AP), KEAP1 (10503-2-AP), GCLM (14241-1-AP), tubulin (10094-1-AP), lamin A/C (10298-1-AP), and β-actin (60008-1-Ig) were obtained from Proteintech (Wuhan, China).

Techniques: Expressing, Membrane, Labeling

Subcellular localization of  NRF1-742  and NRF1-772 proteins and their derivative bands under normal or iAs 3+ treatment conditions.

Journal: International Journal of Molecular Sciences

Article Title: Overexpression of NRF1-742 or NRF1-772 Reduces Arsenic-Induced Cytotoxicity and Apoptosis in Human HaCaT Keratinocytes

doi: 10.3390/ijms21062014

Figure Lengend Snippet: Subcellular localization of NRF1-742 and NRF1-772 proteins and their derivative bands under normal or iAs 3+ treatment conditions.

Article Snippet: The antibodies against NRF1 (17062-1-AP), NQO1 (11451-1-AP), GCLC (12601-1-AP), KEAP1 (10503-2-AP), GCLM (14241-1-AP), tubulin (10094-1-AP), lamin A/C (10298-1-AP), and β-actin (60008-1-Ig) were obtained from Proteintech (Wuhan, China).

Techniques:

Effects of ER stressors and deglycosylase on NRF1 migration. Immunoblotting of NRF1 in whole cell lysates from Cont -OE ( A – C ), NRF1-742 -OE ( D – F ), or NRF1-772 -OE ( G – I ) cells 6 h post-treatment with the indicated agents. The doses of the agents were as follows: vehicle (0.5% DMSO), 10 μM iAs 3+ , 2 μg/mL Tunicamycin (TU), 1 μg/mL Brefeldin A (BFA), or 2 μM Thapsigargin (TG). ( A , D , G ) Samples were treated with Endo H (1000 U) at 37 °C for 1 h. ( B , E , H ) PNGase F-catalyzed deglycosylation (500 U) was performed for 1 h at 37 °C. Immunoblotting was performed with NRF1 and β-actin antibodies. Quantification of the NRF1 bands after deglycosylase treatment is shown in the .

Journal: International Journal of Molecular Sciences

Article Title: Overexpression of NRF1-742 or NRF1-772 Reduces Arsenic-Induced Cytotoxicity and Apoptosis in Human HaCaT Keratinocytes

doi: 10.3390/ijms21062014

Figure Lengend Snippet: Effects of ER stressors and deglycosylase on NRF1 migration. Immunoblotting of NRF1 in whole cell lysates from Cont -OE ( A – C ), NRF1-742 -OE ( D – F ), or NRF1-772 -OE ( G – I ) cells 6 h post-treatment with the indicated agents. The doses of the agents were as follows: vehicle (0.5% DMSO), 10 μM iAs 3+ , 2 μg/mL Tunicamycin (TU), 1 μg/mL Brefeldin A (BFA), or 2 μM Thapsigargin (TG). ( A , D , G ) Samples were treated with Endo H (1000 U) at 37 °C for 1 h. ( B , E , H ) PNGase F-catalyzed deglycosylation (500 U) was performed for 1 h at 37 °C. Immunoblotting was performed with NRF1 and β-actin antibodies. Quantification of the NRF1 bands after deglycosylase treatment is shown in the .

Article Snippet: The antibodies against NRF1 (17062-1-AP), NQO1 (11451-1-AP), GCLC (12601-1-AP), KEAP1 (10503-2-AP), GCLM (14241-1-AP), tubulin (10094-1-AP), lamin A/C (10298-1-AP), and β-actin (60008-1-Ig) were obtained from Proteintech (Wuhan, China).

Techniques: Migration, Western Blot

NRF1-742 -OE and NRF1-772 -OE HaCaT cells are resistant to the iAs 3+ -induced cytotoxicity. ( A ) Cell viability was assessed by the MTS assay 24 h of post- iAs 3+ exposure ( n = 6). The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE cells versus Cont -OE HaCaT cells. ( B ) Representative flow cytometry images of Annexin Ⅴ and PI staining. ( C ) Quantitative analysis of apoptosis. Cells were treated with the indicated concentrations of iAs 3+ for 18 h. The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE cells versus Cont -OE HaCaT cells. ( D , E ) Cleaved PARP and caspase-3 immunoblotting of whole cell lysates from HaCaT cells treated with 30 μM iAs 3+ for 6 h. β-actin served as the loading control.

Journal: International Journal of Molecular Sciences

Article Title: Overexpression of NRF1-742 or NRF1-772 Reduces Arsenic-Induced Cytotoxicity and Apoptosis in Human HaCaT Keratinocytes

doi: 10.3390/ijms21062014

Figure Lengend Snippet: NRF1-742 -OE and NRF1-772 -OE HaCaT cells are resistant to the iAs 3+ -induced cytotoxicity. ( A ) Cell viability was assessed by the MTS assay 24 h of post- iAs 3+ exposure ( n = 6). The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE cells versus Cont -OE HaCaT cells. ( B ) Representative flow cytometry images of Annexin Ⅴ and PI staining. ( C ) Quantitative analysis of apoptosis. Cells were treated with the indicated concentrations of iAs 3+ for 18 h. The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE cells versus Cont -OE HaCaT cells. ( D , E ) Cleaved PARP and caspase-3 immunoblotting of whole cell lysates from HaCaT cells treated with 30 μM iAs 3+ for 6 h. β-actin served as the loading control.

Article Snippet: The antibodies against NRF1 (17062-1-AP), NQO1 (11451-1-AP), GCLC (12601-1-AP), KEAP1 (10503-2-AP), GCLM (14241-1-AP), tubulin (10094-1-AP), lamin A/C (10298-1-AP), and β-actin (60008-1-Ig) were obtained from Proteintech (Wuhan, China).

Techniques: MTS Assay, Flow Cytometry, Staining, Western Blot, Control

Crosstalk between NRF1, nuclear factor erythroid 2-like 2 (NRF2), and Kelch-like ECH- associated protein 1 (KEAP1). Cells were exposed to 10 μM iAs 3+ or vehicle for 6 h. Immunoblotting of NRF2 in whole-cell lysates ( A ) and nuclear cell fractions ( C ). Quantification of NRF2 bands in whole-cell lysates ( B ) and the nuclear fractions ( D ). (E-F) RT-qPCR analysis of NRF2 and KEAP1 expression in response to acute iAs 3+ exposure ( n = 6). The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE cells versus Cont -OE HaCaT cells.

Journal: International Journal of Molecular Sciences

Article Title: Overexpression of NRF1-742 or NRF1-772 Reduces Arsenic-Induced Cytotoxicity and Apoptosis in Human HaCaT Keratinocytes

doi: 10.3390/ijms21062014

Figure Lengend Snippet: Crosstalk between NRF1, nuclear factor erythroid 2-like 2 (NRF2), and Kelch-like ECH- associated protein 1 (KEAP1). Cells were exposed to 10 μM iAs 3+ or vehicle for 6 h. Immunoblotting of NRF2 in whole-cell lysates ( A ) and nuclear cell fractions ( C ). Quantification of NRF2 bands in whole-cell lysates ( B ) and the nuclear fractions ( D ). (E-F) RT-qPCR analysis of NRF2 and KEAP1 expression in response to acute iAs 3+ exposure ( n = 6). The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE cells versus Cont -OE HaCaT cells.

Article Snippet: The antibodies against NRF1 (17062-1-AP), NQO1 (11451-1-AP), GCLC (12601-1-AP), KEAP1 (10503-2-AP), GCLM (14241-1-AP), tubulin (10094-1-AP), lamin A/C (10298-1-AP), and β-actin (60008-1-Ig) were obtained from Proteintech (Wuhan, China).

Techniques: Western Blot, Quantitative RT-PCR, Expressing

Expression of ARE-antioxidant genes, PSMC3 , PSMC4 , and XPC . ( A ) Antioxidant protein expression (GCLC, GCLM, and NQO1) was measured by immunoblotting after treatment with 10 μM iAs 3+ or vehicle for 6 h. ( B – D ) Quantification of GCLC, GCLM, and NQO1 protein levels. ( E – J ) RT-qPCR analysis of the expression of antioxidant response element (ARE)-antioxidant genes ( E – G ), PSMC3 ( H ), PSMC4 ( I ), and XPC ( J ) following vehicle or iAs 3+ treatment ( n = 6). The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE versus Cont -OE HaCaT cells.

Journal: International Journal of Molecular Sciences

Article Title: Overexpression of NRF1-742 or NRF1-772 Reduces Arsenic-Induced Cytotoxicity and Apoptosis in Human HaCaT Keratinocytes

doi: 10.3390/ijms21062014

Figure Lengend Snippet: Expression of ARE-antioxidant genes, PSMC3 , PSMC4 , and XPC . ( A ) Antioxidant protein expression (GCLC, GCLM, and NQO1) was measured by immunoblotting after treatment with 10 μM iAs 3+ or vehicle for 6 h. ( B – D ) Quantification of GCLC, GCLM, and NQO1 protein levels. ( E – J ) RT-qPCR analysis of the expression of antioxidant response element (ARE)-antioxidant genes ( E – G ), PSMC3 ( H ), PSMC4 ( I ), and XPC ( J ) following vehicle or iAs 3+ treatment ( n = 6). The data are presented as the mean ± SD; * p < 0.05, NRF1-742 -OE versus Cont -OE HaCaT cells; # p < 0.05, NRF1-772 -OE versus Cont -OE HaCaT cells.

Article Snippet: The antibodies against NRF1 (17062-1-AP), NQO1 (11451-1-AP), GCLC (12601-1-AP), KEAP1 (10503-2-AP), GCLM (14241-1-AP), tubulin (10094-1-AP), lamin A/C (10298-1-AP), and β-actin (60008-1-Ig) were obtained from Proteintech (Wuhan, China).

Techniques: Expressing, Western Blot, Quantitative RT-PCR